IONIS-MAPTRx (Synonyms: BIIB080; ISIS 814907) |
| Catalog No.GC69287 |
IONIS-MAPTRx (BIIB080) es el primer oligonucleótido antisentido (ASO) que reduce los niveles de Tau. IONIS-MAPTRx tiene potencial para investigar la enfermedad de Alzheimer. (IONIS-MAPTRx se utiliza en ratones: secuencia TauASO-12 - 5′ GCTTTTACTGACCATGCGAG 3′)
Products are for research use only. Not for human use. We do not sell to patients.
Cas No.: 2857842-32-9
Sample solution is provided at 25 µL, 10mM.
;)
,-1-7$$$37316672.jpg');)
;)
;)
$$$36806353.jpg');)
;33(7)%EF%BC%9A546-561$$$37156877.jpg');)
;)
;)
;)
%201124-1138.$$$35908550.jpg');)
%20766-780.$$$37100057.jpg');)
%20418-432.$$$36893736.jpg');)
%EF%BC%9A-240-255.$$$35108512.jpg');)
533-545$$$36543525.jpg');)
%201-13.$$$36600053.jpg');)
;)
Review for IONIS-MAPTRx
Average Rating: 5 (Based on Reviews and 30 reference(s) in Google Scholar.)
Review for IONIS-MAPTRx
GLPBIO products are for RESEARCH USE ONLY. Please make sure your review or question is research based.
Required fields are marked with *